 |  | - GEO Publications
- Handout
- NAR 2024 (latest)
- NAR 2002 (original)
- All publications
- FAQ
- MIAME
- Email GEO
|  |  | NCBI > GEO > Accession Display | Not logged in | Login |
|  | |  | | | | GEO help: Mouse over screen elements for information. |
| Scope: Self Platform Samples Series Family Format: HTML SOFT MINiML Amount: Brief Quick GEO accession: |  |
|
|
| Sample GSM5259534 | Query DataSets for GSM5259534 |
| | Status | Public on Apr 23, 2021 | | Title | Polysome fraction 16 | | Sample type | SRA | | Source name | Cell culture | | Organism | Homo sapiens | | Characteristics | tissue: HEK293T cell line | | Extracted molecule | total RNA | | Extraction protocol | Cell culture media was replaced with cycloheximide (MilliporeSigma, C7698-1G) containing media at 100ug/mL. After 2 minutes, cells were washed, trypsinized and harvested using PBS, trypsin, and culture media containing 100 g/mL cycloheximide. ~10x106 cells were resuspended in 400 µL of following lysis buffer on ice for 30 min, vortexing every 10 min: 25 mM Tris-HCl pH 7.5, 150 mM NaCl, 15 mM MgCl2, 1 mM DTT, 8% glycerol, 1% Triton X-100, 100 µg/mL cycloheximide, 0.2 U/µL Superase-In RNase inhibitor (ThermoFisher Scientific, AM2694), 1x Halt protease inhibitor cocktail (ThermoFisher Scientific, 78430), 0.02 U/µL TURBO DNase (ThermoFisher Scientific, AM2238). After lysis, nuclei were removed by two step centrifuging, first at 1300 g for 5min and second at 10000 g for 5min, taking the supernatants from each. 25%-50% sucrose gradient was prepared in 13.2mL ultracentrifuge tubes (Beckman Coulter, 331372) using Biocomp Gradient Master with the following recipe: 25 or 50% sucrose (w/v), 25 mM Tris-HCl pH 7.5, 150 mM NaCl, 15 mM MgCl2 , 1 mM DTT, 100 µg/mL cycloheximide. The lysate was layered onto the sucrose gradient and ultracentrifuged on Beckman Coulter SW-41Ti rotor at 40000rpm for 150min at 4°C. The gradient was density fractionated using Brandel BR-188 into 16x750 µL fractions, and in vitro transcribed spike-in RNA mix (120002B1, 120010B1, 220023B1, 310333T3; 1000, 100, 10, 1-fold dilutions respectively) were added to each fraction. 700 µL of each fraction was mixed with 100µL 10% SDS, 200µL 1.5M sodium acetate, and 900µL acid phenol-chloroform, pH 4.5 (ThermoFisher Scientific, AM9720), heated at 65°C for 5min, and centrifuged at 20000g for 15min at 4°C for phase separation. 600µL aqueous phase was mixed with 600 µL 100% ethanol and RNA was purified on silica columns (Zymo, R1013).Up to 250 ng RNA in 2.75 µL was mixed with 0.25 µL 2 µM RT_Const2_N12_Read1Partial (TCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNtcaccacggcgtgagatcagcg) and 0.25 µL 10mM dNTPs each. The RNA samples were then denatured at 65°C for 5 min and chilled to 4°C. 1.75 µL reverse transcription mix was added to 5 µL total reaction volume: 1 µL 5x Superscript IV buffer, 0.25 µL 10mM DTT, 0.25 µL Superase-In (ThermoFisher Scientific, AM2694), 0.25 µL Superscript IV (Thermo 18091050). The reaction was incubated at 55°C for 45 min and inactivated at 80°C for 10 min. First round PCR was performed under following conditions: 1 µL RT reaction, 10 µL 2x Q5 Hot Start Master Mix (NEB M0494S), 0.2 µL 100x SYBR (Thermo S7563), 1 µL 10uM Read1Partial_F (TCTTTCCCTACACGACGCTCTTCCGATCT), 1 µL 10 uM 50:50 Hbb_Fwd:Nluc_Fwd mix in 20 µL total volume. Cycling conditions were: 98°C for 60 sec, and 15 cycles of 98°C for 10 sec, 68°C for 10 sec and 72°C. Second round PCR was performed under the following conditions: 1 µL first round PCR, 10 µL 2x Q5 Hot Start Master Mix, 0.2 µL 100x SYBR, 1 µL 10 uM Read1Partial_F, 1 µL 10 uM Read2Partial_Const1_R (GGAGTTCAGACGTGTGCTCTTCCGATCTttctagagcggccgcttcgagc) in 20 µL total volume. Cycling conditions were: 98°C for 60 sec, and 5 cycles of 98°C for 10 sec, 72°C for 5 sec. Sequencing adaptors were added using the following conditions for final round PCR: 1 µL second round PCR, 10 µL 2x Q5 Hot Start Master Mix, 0.2 µL 100x SYBR, 1 µL 10 µM NEBNext Index Primer (NEB E7335, NEB E7500, NEB E7710, NEB E7730, NEB E6609), 1 µL 10 µM NEBNext Universal PCR Primer in 20 µL total volume. Cycling conditions were: 98°C for 60 sec, and 5 cycles of 98°C for 10 sec, 72°C for 5 sec. All barcoded samples were then pooled at equal volumes and purified with 1.1x SPRIselect beads (Beckman Coulter B23317). | | Library strategy | OTHER | | Library source | transcriptomic | | Library selection | other | | Instrument model | NextSeq 550 | | Data processing | Library strategy: Barcode amplicon sequencingConstant regions were trimmed using cutadapt. The trimmed reads were aligned to the indexed reference of barcode sequences using Bowtie2 with the following options: -L 11 -N 0 --nofw 89. The alignments were deduplicated based on UMIs using UMIcollapse with -p 0.05 and counted using samtools available under idxstats. This pipeline yields a matrix of barcode read counts where rows are the different constructs in the library and columns are the different samples. The count matrix was log transformed and normalized column-wise using a linear fit on the dilution series of spike-in constructs in each sample. For the calculation of RNA degradation coefficients in cells, we carried out a linear fit to log RNA abundance from the time course data, i.e. we fit an expression of Y = β0+β1 t where Y is the normalized log RNA abundance and t is the number of hours after transfection; β1 is the degradation constant. For the calculation of in solution degradation coefficients, sufficient data points were available to carry out a nonlinear fit directly to an exponential model, i.e. we fit an expression of y = A exp(-𝛕/t), where y is the fraction intact (RNA abundance normalized to initial abundance), A is the amplitude, t is the time of incubation in degradation buffer in hours, and 𝛕 is the degradation time constant. For polysome profiles, percent RNA abundances for each fraction were first calculated by scaling per-fraction values by the sum of all fractions. For the heatmap displays in the figures, column medians were also subtracted from each percent RNA value. For the calculation of ribosome load, the matrix of percent RNA abundances in fractions 4-9 (1-3 are free RNP fractions, and >9 have negligible abundance) were first multiplied by a weight vector representing the number of ribosomes in each fraction as determined by the A260 trace from the fractionator, then the weighted abundances were summed across the row. For the calculation of polysome to monosome ratio, the sum of fractions 7-9 (>3 ribosomes) abundances were divided by fraction 4 (80S) abundance. For the calculation of monosome to 40S/60S ratio, fraction 4 (80S) abundance was divided by the sum of fraction 2 (40S/60S) abundance.processed data files format and content: Table S1 is an XLSX file containing the final polysome profile metrics and degradation statistics for each of the 233 constructs in the input library. | | Submission date | Apr 22, 2021 | | Last update date | Apr 23, 2021 | | Contact name | Rhiju Das | | E-mail(s) | rhiju@stanford.edu | | Organization name | Stanford University School of Medicin | | Department | Biochemistry | | Lab | Das | | Street address | 279 Campus Dr, B419 Beckman Center | | City | Stanford | | State/province | California | | ZIP/Postal code | 94305 | | Country | USA | | Platform ID | GPL21697 | | Series (1) | | GSE173083 | Combinatorial optimization of mRNA structure, stability, and translation for RNA-based therapeutics |
| | Relations | | BioSample | SAMN18828645 | | SRA | SRX10656826 |
| Supplementary data files not provided | | SRA Run Selector | | Raw data are available in SRA | | Processed data are available on Series record |
|
| | | |  | |  | | | NLM | NIH | GEO Help | Disclaimer | Accessibility | |
Copyright © 2022 | Thiết Kế Truyền Hình Cáp Sông Thu
|
