PCfB3053(gRNA X-2, XI-5, XII-4) (Plasmid #73295) - Addgene

  • Image: Illustrated plasmid map in PNG format

  • GenBank File: Plasmid sequence and annotations. Use text editor or plasmid mapping software to view sequence.

  • SnapGene File: Plasmid sequence and SnapGene enhanced annotations. Use with SnapGene software or the free Viewer to visualize additional data and align other sequences.

Close 166664_map Download File
  • Image
  • GenBank
  • SnapGene
View all sequences Close Close 134842_map Download File
  • Image
  • GenBank
  • SnapGene
View all sequences Close

Addgene Website Feedback

Need help? Send us an email at [email protected] Privacy Policy Skip to main content
  • Browse
  • Irina Borodina
  • Jessop-Fabre et al
  • pCfB3053(gRNA X-2, XI-5, XII-4)
pCfB3053(gRNA X-2, XI-5, XII-4) (Plasmid #73295) Print
  • Purpose EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4
  • Depositing Lab Irina Borodina
  • Publication Jessop-Fabre et al Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. ( How to cite )
  • Sequence Information
    • Sequences (5)
166664_map
  • Enlarge
  • View all sequences
134842_map
  • Enlarge
  • View all sequences

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73295 Standard format: Plasmid sent in bacteria as agar stab 1 $85 Add to Cart

Backbone

  • Vector backbone pESC-Leu
  • Backbone manufacturer Agilent
  • Backbone size w/o insert (bp) 7758
  • Total vector size (bp) 6145
  • Modifications to backbone Gal promoters and terminators removed and Leu selectable marker replaced with NatMX marker. Modified to accept enable USER cloning, with the 20bp recognition sequence replaced to target site X-2, XI-5, XII-4 as reported in: Ronda, C., Maury, J., Jakočiūnas, T., Jacobsen, S. A. et al., CrEdit: CRISPR mediated multi-loci gene integration in Saccharomyces cerevisiae. Microb. Cell Fact. 2015, 14, 97.
  • Vector type Yeast Expression, CRISPR ; gRNA
  • Selectable markers nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s) Ampicillin, 100 μg/mL
  • Growth Temperature 37°C
  • Growth Strain(s) DH5alpha
  • Copy number High Copy

Gene/Insert

  • Gene/Insert name guiding RNA
  • gRNA/shRNA sequence ctctcgaagtggtcacgtgc,tgagaatactgttgtaaaac, gcttcaagaattgagtaaac
  • Species S. cerevisiae (budding yeast)

Resource Information

  • Supplemental Documents
    • pCfB3053(gRNA X-2, XI-5, XII-4)
  • Article Citing this Plasmid
    • 1 Reference

Terms and Licenses

  • Academic/Nonprofit Terms
    • UBMTA
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that mutation A40T in nourseothricin was foud during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCfB3053(gRNA X-2, XI-5, XII-4) was a gift from Irina Borodina (Addgene plasmid # 73295 ; http://n2t.net/addgene:73295 ; RRID:Addgene_73295)
  • For your References section:

    EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Jessop-Fabre MM, Jakociunas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. 10.1002/biot.201600147 PubMed 27166612
Included in kit:
  • EasyClone-MarkerFree Vector Set
Related items:
  • From this article
  • Irina Borodina Lab Plasmids
  • CRISPR gRNAs
  • CRISPR/Cas Items
Commonly requested with:
  • pCfB3051(gRNA X-3 XI-2 XII-2)
  • pCfB3052(gRNA X-4, XI-3, XII-5)
  • pCfB3038(XII-1 MarkerFree)
  • pCfB2899(X-2 MarkerFree)
  • pCfB2909(XII-5 MarkerFree)

Từ khóa » Xi E Xii