Protocol 21220 - Trem2 - The Jackson Laboratory
- Research & Faculty
- Overview
- Locations
- JAX Mammalian Genetics - Maine
- JAX Genomic Medicine - Connecticut
- Faculty A-Z
- Labs A-Z
- Research Centers
- Scientific Services
- Data Science
- Tools & Resources
- Working at JAX
- Education & Learning
- Education & Learning Home
- Online Learning
- Courses
- In Person & Virtual
- Online MicroLessons and MiniCourses
- Bioinformatics Training Program
- Clinicians
- Course Offerings
- Clinical Resources
- Postbac, Ph.D. & Postdocs
- Postbaccalaureate Training
- Cooperative Ph.D. Training at JA
- Postdoctoral Associates
- Students & Teachers
- Science Fair
- Summer Student Program
- Fellowships
- Teacher Professional Development
- Genetics Learning Resources
- College Scholarship
- Jax® Mice & Services
- Innovative Research
- Breakthrough Lab
- Research Resiliency
- Find Mice & Biospecimens
- Why JAX Mice
- Search JAX Mice
- Order JAX Mice
- Biospecimens
- Services for Mice
- Custom Model Generation
- Colony Management
- Surgical & Preconditioning Services
- Preclinical Research Services
- Preclinical Oncology Platforms​
- PDX Models
- Humanized
- Neurobiology
- Immunology
- Antibody Therapeutics
- Safety and Efficacy Studies
- Disease Area
- Cardiovascular
- Immunology
- Metabolic Diseases
- Neurobiology
- Oncology
- Rare Diseases
- Customer Resources
- Technical Help
- Quality Team
- Consulting & Advisory Services
- Resource Center
- Events
- JAX Envisionâ„¢
- Innovative Research
- Personalized Medicine
- What is Personalized Medicine?
- Genetics vs. genomics
- Ethical considerations
- Personalized medicine and you
- What is CRISPR?
- Mice in Biomedical Research
- Areas of Research
- Addiction
- Aging
- Alzheimer\'s & Other Dementias
- Cancer
- Diabetes
- Endometriosis Research at JAX
- Microbiome
- Vision
- Advanced Precision Medicine Laboratory
- Maine Cancer Genomics Initiative
- What is Personalized Medicine?
- News
- News & Insights
- JAX Blog
- Minute to Understanding
- Subscribe
- The Search Magazine
- Explore by Topic
- About Us
- Fast Facts
- Our People & Culture
- Our Values
- Belonging at JAX
- Faces of JAX
- Our Leaders
- Work With Us
- Our History
- Our Campuses & Communities
- Our Impact
- Collaboration at JAX
- Our Medical Impact
- Our Economic Impact
- Our Community Impact
- Our Environmental Impact
- Careers
- Contact Us
- Give
Notes
Mut = G
WT= A
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.Expected Results
Sequence
cttccaagcaagtggctgtctcctctgcagCCCTGTCCCAAGCCCTCAACACCACGGTGCTGCAGGGCATGGCCGGCCAGTCCTTGAGGGTGTCATGTACTT(A/G)TGACGCCTTGAAGCA
CTGGGGGAGACGCAAGGCCTGGTGTCGGCAGCTGGGTGAGGAGGGCCCATGCCAGCGTGTGGTGAGCACACACGGTGTGTGGCTGCTGGCCTTCCTGAAGAAGCGGAATG
GGAGCACAGTCATCGCAGATGACACCCTTGCTGGAACCGTCACCATCACTCTGAAGAACCTCCAAGCCGGTGACGCGGGCCTCTACCAGTGTCAGAGTCTCCGAGGCCGAGA
GGCTGAGGTCCTGCAGAAAGTACTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 31988 | CAA GTG GCT GTC TCC TCT GC | Forward | A | |||
| 31989 | CGG AGA CTC TGA CAC TGG TAG | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 31988 | 0.50 uM |
| 31989 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
Strains Using This Protocol
This is the only strain that uses this protocol. For in-depth product & services help, ask our Technical Information ScientistsWe use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.
SettingsAllow essential cookies
Required for basic site operations.
Allow analytics cookies
Used to analyze web traffic to improve the user experience.
Allow marketing cookies
Used to deliver personalized information and tailor communications.
Save and closeTừ khóa » Gc 21220
-
Https://www.leginfo..gov/faces/codes...
-
A-Frame Gantry Crane - Air Technical Industries
-
GLENCAIRN EDUCATIONAL SERVICES (21220-156321/001/MCT ...
-
Subscribe To Email Notifications For: Snow Removal (21220-14 ...
-
1000E21220 | CXY Grindstone | NORITAKE | MISUMI Vietnam
-
[PDF] Post Retirement Employment: CalPERS' Retirees
-
Scrip Number 21220 - Amount 51.65$
-
Diner On The Go - 21220, USAJohns Hopkins University... | Facebook
-
Stator, 6V Assembly, SIL-10ADvp - Shimadzu Scientific Instruments
-
905 Oakdene Rd, Middle River, MD 21220 | Redfin
-
Shimadzu Stator, 6V Assy, Sil-10ADvp - 228-21220-94
-
Mianserine On Lux 5µm Cellulose-1 By SFC - Phenomenex
-
Retirement - Faculty Affairs - Fresno State