Protocol 37677 - Col1a1

• Research & Faculty 
  • Overview
  • Locations
    • JAX Mammalian Genetics - Maine
    • JAX Genomic Medicine - Connecticut
  • Faculty A-Z
  • Labs A-Z
  • Research Centers
  • Scientific Services
  • Data Science
  • Tools & Resources
  • Working at JAX
• Education & Learning 
  • Education & Learning Home
  • Online Learning
  • Courses
    • In Person & Virtual
    • Online MicroLessons and MiniCourses
    • Bioinformatics Training Program
  • Clinicians
    • Course Offerings
    • Clinical Resources
  • Postbac, Ph.D. & Postdocs
    • Postbaccalaureate Training
    • Cooperative Ph.D. Training at JA
    • Postdoctoral Associates
  • Students & Teachers
    • Science Fair
    • Summer Student Program
    • Fellowships
    • Teacher Professional Development
    • Genetics Learning Resources
    • College Scholarship
• Jax® Mice & Services 
  • Innovative Research
    • Breakthrough Lab
    • Research Resiliency
  • Find Mice & Biospecimens
    • Why JAX Mice
    • Search JAX Mice
    • Order JAX Mice
    • Biospecimens
  • Services for Mice
    • Custom Model Generation
    • Colony Management
    • Surgical & Preconditioning Services
  • Preclinical Research Services
    • Preclinical Oncology Platforms​
    • PDX Models
    • Humanized
    • Neurobiology
    • Immunology
    • Antibody Therapeutics
    • Safety and Efficacy Studies
  • Disease Area
    • Cardiovascular
    • Immunology
    • Metabolic Diseases
    • Neurobiology
    • Oncology
    • Rare Diseases
  • Customer Resources
    • Technical Help
    • Quality Team
    • Consulting & Advisory Services
    • Resource Center
  • Events
  • JAX Envisionâ„¢
• Personalized Medicine 
  • What is Personalized Medicine?
    • Genetics vs. genomics
    • Ethical considerations
    • Personalized medicine and you
    • What is CRISPR?
  • Mice in Biomedical Research
  • Areas of Research
    • Addiction
    • Aging
    • Alzheimer\'s & Other Dementias
    • Cancer
    • Diabetes
    • Endometriosis Research at JAX
    • Microbiome
    • Vision
  • Advanced Precision Medicine Laboratory
  • Maine Cancer Genomics Initiative
• News 
  • News & Insights
  • JAX Blog
  • Minute to Understanding
  • Subscribe
  • The Search Magazine
  • Explore by Topic
• About Us 
  • Fast Facts
  • Our People & Culture
    • Our Values
    • Belonging at JAX
    • Faces of JAX
    • Our Leaders
    • Work With Us
  • Our History
  • Our Campuses & Communities
  • Our Impact
    • Collaboration at JAX
    • Our Medical Impact
    • Our Economic Impact
    • Our Community Impact
    • Our Environmental Impact
  • Careers
  • Contact Us
• Give

B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm5(tetO-H3f3a*K9M)Hoch/J Stock No: 034366 Protocol 37677: Standard PCR Assay - Col1a1<tm#(tetO-H3f3a)Hoch> Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:94953435+94953633 199bp CCATCCCAACAATACATCACA TGGTTTCTTTGGGCTAGAGG

Mutant = 263 bp Heterozygote = 263 bp and 199 bp Wild type = 199 bp

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction	Note
25360	TGG TTT CTT TGG GCT AGA GG	Wild type Reverse	A	Wt R
31015	CCA TCC CAA CAA TAC ATC ACA	Wild type Forward	A	Wt F
51940	TCT GGT TGG CCT TTT TGA AG	Mutant Forward	A	Mut F
oIMR1374	GGG TCC ATG GTG ATA CAA GG	Mutant Reverse	A	Mut R

Reaction A

Component	Final Concentration
ddH2O
Kapa 2G HS buffer	1.30 X
MgCl2	2.60 mM
dNTP KAPA	0.26 mM
25360	0.50 uM
31015	0.50 uM
51940	0.50 uM
oIMR1374	0.50 uM
Glycerol	6.50 %
Dye	1.00 X
Kapa 2G HS taq polym	0.03 U/ul
DNA

Cycling

Step	Temp °C	Time	Note
1	94.0	--
2	94.0	--
3	65.0	--	-0.5 C per cycle decrease
4	68.0	--
5	--	repeat steps 2-4 for 10 cycles (Touchdown)
6	94.0	--
7	60.0	--
8	72.0	--
9	--	repeat steps 6-8 for 28 cycles
10	72.0	--
11	10.0	--	hold

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents. JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number	Strain Name
034364	B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm3(tetO-H3f3a)Hoch/J
034366	B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm5(tetO-H3f3a*K9M)Hoch/J
2 strains use this protocol

For in-depth product & services help, ask our Technical Information Scientists

We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.

Settings

Allow essential cookies

Required for basic site operations.

Allow analytics cookies

Used to analyze web traffic to improve the user experience.

Allow marketing cookies

Used to deliver personalized information and tailor communications.

Save and close