Welcome
{{ username}} Message Center {{ messageCount }} Messages Go to Message Center Watched Genes {{$index + 1}}.
{{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}}) Modify Subscription Unsubscribe Watched Ontology Terms {{$index + 1}}.
{{ watchedTerm.term }} ({{watchedTerm.accId}}) Modify Subscription Unsubscribe Close Window
{{gene.symbol}}: {{ gene.description }} ×
Save List to My RGD
| Create Name: |
| Description: |
Save List
| You must be logged in to use this feature |
| {{ loginError }} |
{{ watchLinkText }}
Select categories you would like to watch. Updates to this gene will be sent to {{ username }}
Cancel
Unsubscribe from this Object Save
Analyze GeneStrainQTL List | × |
Gene Annotator (Functional Annotation)unavailable | Gene Annotator (Annotation Distribution)unavailable | Variant Visualizer (Genomic Variants) unavailbleVariant Visualizer (Genomic Variants)unavailable |
| Gene Annotator (Functional Annotation) | Gene Annotator (Annotation Distribution) | Variant Visualizer (Genomic Variants) |
InterViewer (Protein-Protein Interactions)unavailable | Gviewer (Genome Viewer)unavailable | Variant Visualizer (Damaging Variants) unavailbleVariant Visualizer (Damaging Variants)unavailable |
| InterViewer (Protein-Protein Interactions) | GViewer (Genome Viewer) | Variant Visualizer (Damaging Variants) |
Gene Annotator (Annotation Comparison)unavailable | OLGA (Gene List Generator)unavailable |  |
| Gene Annotator (Annotation Comparison) | OLGA (Gene List Generator) | Excel (Download) |
MOET (Multi-Ontology Enrichement)unavailable | GOLF (Gene-Ortholog Location Finder)unavailable |
| MOET (Multi-Ontology Enrichement) | GOLF (Gene-Ortholog Location Finder) |
| | Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact | | | Home Search RGD Grant Resources Citing RGD About Us Contact Us Data Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data Analysis & Visualization OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quantitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Diseases Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Phenotypes & Models Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Community Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources | | Advanced Search (OLGA) | | |
Marker: STS-H13265 | | Symbol: | STS-H13265 | | Previously known as: | | RGD ID: | 2158761 | | Expected Size: | 173 (bp) | | Position | | Human Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
GRCh37 | 6 | 45,879,398 - 45,879,570 | UniSTS | GRCh37 | Build 36 | 6 | 45,987,376 - 45,987,548 | RGD | NCBI36 | Celera | 6 | 47,432,283 - 47,432,455 | RGD | Cytogenetic Map | 6 | p12.3 | UniSTS | HuRef | 6 | 45,602,771 - 45,602,943 | UniSTS | GeneMap99-GB4 RH Map | 6 | 173.82 | UniSTS |
| | Is Marker For: | Genes: CLIC5 | Annotation References - curated 10 20 30 40 100 All Rows | # | Reference Title | Reference Citation | | 1. | UniSTS Pipeline | RGD automated pipelines | 10 20 30 40 100 All Rows Strains and Sequence Sequence | Forward Primer | GGCAGAATGTTAGTTTCAATACAGC | | Reverse Primer | ACAGGTCCTTCGTTGGGAG | Region Nucleotide Sequences 3 5 10 20 30 100 All Rows | RefSeq Transcripts | NM_001256023.1 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | GenBank Nucleotide | AK075144 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | AL357057 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | BC039380 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | CH003453 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | CH003501 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | CH471081 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | CM000257 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | CM000467 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | CM000496 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | CM000668 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | CM001614.1 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | DS486063 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | DS990701 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | GL000052 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | GL297350.1 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | GL583034 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | | JH976331.1 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | 3 5 10 20 30 100 All Rows Additional Information External Database Links 3 5 10 20 40 100 All Rows | Database | Acc Id | Source(s) | | NCBI Gene | 53405 | UniSTS | 3 5 10 20 40 100 All Rows | |