PMAL-c4X (Plasmid #75288) - Addgene

More than 20 requests

More than 50 requests

More than 100 requests

• Image: Illustrated plasmid map in PNG format

• GenBank File: Plasmid sequence and annotations. Use text editor or plasmid mapping software to view sequence.

• SnapGene File: Plasmid sequence and SnapGene enhanced annotations. Use with SnapGene software or the free Viewer to visualize additional data and align other sequences.

× Close

Depositor Full Sequence Map for pMAL-c4X

Download File

• Image
• GenBank
• SnapGene

View all sequences Close ×

Addgene Website Feedback

Need help? Send us an email at [email protected] Privacy Policy Skip to main content

• Browse
• Paul Riggs
• Walker et al
• pMAL-c4X

pMAL-c4X (Plasmid #75288) Print

• Purpose (Empty Backbone) Expresses proteins in the cytoplasm as fusions to a high-binding mutant (A313V) maltose-binding protein
• Depositing Lab Paul Riggs
• Publication Walker et al Appl Microbiol Biotechnol. 2010 Sep;88(1):187-97. doi: 10.1007/s00253-010-2696-y. Epub 2010 Jun 10. ( How to cite )
• Sequence Information
  • Sequences (3)

• Enlarge
• View all sequences

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	75288	Standard format: Plasmid sent in bacteria as agar stab	1	$85 *	Add to Cart

* Log in to view industry pricing.

Backbone

• Vector backbone pMAL-c4X
• Backbone manufacturer New England Biolabs
• Backbone size (bp) 6645
• Modifications to backbone malE A313V
• Vector type Bacterial Expression
• Promoter tac
• Tag / Fusion Protein
  • maltose-binding protein (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s) Ampicillin, 100 μg/mL
• Growth Temperature 37°C
• Growth Strain(s) DH5alpha
• Growth instructions Any E. coli strain can be used for expression of fusion proteins; NEBExpress, BL21, or BL21(DE3) are good first choices
• Copy number Low Copy

Cloning Information

• Cloning method Restriction Enzyme
• 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
• 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
(Common Sequencing Primers)

Resource Information

• Articles Citing this Plasmid
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms
  • UBMTA
• Industry Terms
  • Industry MTA

Trademarks:

• Zeocin® is an InvivoGen trademark.

Depositor Comments

Commercial use requires a license from New England Biolabs

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

• For your Materials & Methods section:

  pMAL-c4X was a gift from Paul Riggs (Addgene plasmid # 75288 ; http://n2t.net/addgene:75288 ; RRID:Addgene_75288)

• For your References section:

  Mutations in maltose-binding protein that alter affinity and solubility properties. Walker IH, Hsieh PC, Riggs PD. Appl Microbiol Biotechnol. 2010 Sep;88(1):187-97. doi: 10.1007/s00253-010-2696-y. Epub 2010 Jun 10. 10.1007/s00253-010-2696-y PubMed 20535468

Related items:

• From this article
• Paul Riggs Lab Plasmids

Commonly requested with:

• pMAL-p4X
• pMAL-c2X
• pTRKH3-ermGFP
• pINIT_cat
• pExp-GB1